Top » Catalog » SNPs » YFS2837232

$18.00

YFS2837232
[YFS2837232]

YFS2837232
hg38 Position: ChrY:12153118..12153118
Ancestral: C
Derived: A
Reference: Zachary Daugherty (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: YFS2837232_F TGAGACAAAACACCGTGCTC
Reverse Primer: YFS2837232_R TGAGCAACATGGAACCTGAG
Reviews

Customers who bought this product also purchased
YFS2836884
YFS2836884
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies