Top » Catalog » SNPs » YFS2837312

$18.00

YFS2837312
[YFS2837312]

YFS2837312
hg38 Position: ChrY:21407609..21407609
Ancestral: G
Derived: T
Reference: Zachary Daugherty (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: YFS2837312_F CAGCAGTACCAGCCCACC
Reverse Primer: YFS2837312_R AGTAGCTAGATACAGAGTGTTGATTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies