Top » Catalog » SNPs » A19674

$18.00

A19674
[A19674]

A19674
hg38 Position: ChrY:13297329..13297329
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below A2512
Forward Primer: A19674_F CAGCATCTGCTTCTGGTGAG
Reverse Primer: A19674_R TCCAGAAGTCTTGGCAAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies