Top » Catalog » SNPs » FGC11400

$18.00

FGC11400
[FGC11400]

FGC11400
hg38 Position: ChrY:4767909..4767909
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a2a (not listed)
Comments: Downstream DF27 / Z2571 Rox2 branch
Forward Primer: FGC11400_F TGGCCAGATACCAACTCTTG
Reverse Primer: FGC11400_R AGACGGAGTCTCACTCTGTGG
Reviews

Customers who bought this product also purchased
FGC11385
FGC11385
FGC11396
FGC11396
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies