Top » Catalog » SNPs » A19679

$18.00

A19679
[A19679]

A19679
hg38 Position: ChrY:20906455..20906455
Ancestral: G
Derived: A
Reference: William Johnson (2017)
ISOGG Haplogroup: R1b
Comments: Below DF85
Forward Primer: A19679_F TGATATTCCCAATATTCCTCTTGC
Reverse Primer: A19679_R CAAATGGCAGATTAGGCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies