Top » Catalog » SNPs » A19681

$18.00

A19681
[A19681]

A19681
hg38 Position: ChrY:7804243..7804243
Ancestral: A
Derived: G
Reference: William Johnson (2017)
ISOGG Haplogroup: R1b
Comments: Below DF85
Forward Primer: A19681_F ATCTGTGTGCCTTGCCTAGC
Reverse Primer: A19681_R CTGACTCTCCAGACTGGTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies