Top » Catalog » SNPs » A19682

$18.00

A19682
[A19682]

A19682
hg38 Position: ChrY:8164061..8164061
Ancestral: G
Derived: A
Reference: Oleg Sukhanov (2017)
ISOGG Haplogroup: N
Comments:
Forward Primer: A19682_F TCAGAGAATGCATCAGAGTAATTCTAC
Reverse Primer: A19682_R TTAACACCTTGATTGCAATCTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies