Top » Catalog » SNPs » A19683

$18.00

A19683
[A19683]

A19683
hg38 Position: ChrY:8830065..8830065
Ancestral: T
Derived: C
Reference: Oleg Sukhanov (2017)
ISOGG Haplogroup: N
Comments:
Forward Primer: A19683_F GTTCTATAAGGACTAAAAAGAATTAGGG
Reverse Primer: A19683_R GGCCATGACAAACACTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies