Top » Catalog » SNPs » BY2863

$18.00

BY2863
[BY2863]

BY2863
hg38 Position: ChrY:12469489..12469489
Ancestral: C
Derived: T
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY2863_F GAGTCATTCCTCTATCTGGTATGGC
Reverse Primer: BY2863_R GCTGTGCCATACCATGAATC
Reviews

Customers who bought this product also purchased
FGC11787
FGC11787
Z17805
Z17805
Z16388
Z16388
Z17801
Z17801
Z17810
Z17810
Z16387
Z16387
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies