Top » Catalog » SNPs » FGC11788

$18.00

FGC11788
[FGC11788]

FGC11788
hg38 Position: ChrY:7837749..7837749
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b2c1a1
Comments: downstream of L513 > S6365 > Z16385 > Z16395
Forward Primer: FGC11788_F GTGGCACGGTCTTCAGTTTG
Reverse Primer: FGC11788_R ACTTACCCAATTTTCACCGGTC
Reviews

Customers who bought this product also purchased
Z16392
Z16392
Z17805
Z17805
FGC11787
FGC11787
BY2863
BY2863
Z17810
Z17810
Z16388
Z16388
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies