Top » Catalog » SNPs » Z16392

$18.00

Z16392
[Z16392]

Z16392
hg38 Position: ChrY:12552937..12552937
Ancestral: G
Derived: A
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b2c1a
Comments: downstream of L513
Forward Primer: Z16392_F GTCCTTGTAATTAGTCTCAGAAATCAAG
Reverse Primer: Z16392_R CCCGGCTATCACAATTTCTG
Reviews

Customers who bought this product also purchased
BY2863
BY2863
Z17810
Z17810
Z16387
Z16387
Z17801
Z17801
Z17809
Z17809
FGC11788
FGC11788
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies