Top » Catalog » SNPs » Z17801

$18.00

Z17801
[Z17801]

Z17801
hg38 Position: ChrY:8624317..8624317
Ancestral: T
Derived: G
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L513>S6365
Forward Primer: Z17801_F CACCAAATGGGAGTGGAAAG
Reverse Primer: Z17801_R GGTAGAGATTCAGACAGCTTGCTG
Reviews

Customers who bought this product also purchased
FGC11787
FGC11787
Z17805
Z17805
Z16388
Z16388
BY2863
BY2863
Z17810
Z17810
Z16387
Z16387
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies