Top » Catalog » SNPs » Z17808

$18.00

Z17808
[Z17808]

Z17808
hg38 Position: ChrY:16094323..16094323
Ancestral: C
Derived: T
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L513>S6365
Forward Primer: Z17808_F TGGCTATCTCTGACCTTGCAC
Reverse Primer: Z17808_R GTTTCGGTCTGGGTAAACAATC
Reviews

Customers who bought this product also purchased
Z17810
Z17810
Z16387
Z16387
Z16396
Z16396
Z17809
Z17809
FGC11788
FGC11788
Z16395
Z16395
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies