Top » Catalog » SNPs » Z17809

$18.00

Z17809
[Z17809]

Z17809
hg38 Position: ChrY:19402076..19402076
Ancestral: G
Derived: C
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L513>S6365
Forward Primer: Z17809_F CACATTCTTACATTATATACAATCATTAACTGAG
Reverse Primer: Z17809_R CTTAACAATAGACATTCTGATTGATATGAG
Reviews

Customers who bought this product also purchased
Z17806
Z17806
Z16392
Z16392
Z17805
Z17805
FGC11787
FGC11787
BY2863
BY2863
Z16388
Z16388
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies