Top » Catalog » SNPs » Z17809

$18.00

Z17809
[Z17809]

Z17809
hg38 Position: ChrY:19402076..19402076
Ancestral: G
Derived: C
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L513>S6365
Forward Primer: Z17809_F CACATTCTTACATTATATACAATCATTAACTGAG
Reverse Primer: Z17809_R CTTAACAATAGACATTCTGATTGATATGAG
Reviews

Customers who bought this product also purchased
Z17801
Z17801
Z17810
Z17810
Z16387
Z16387
Z16396
Z16396
Z17808
Z17808
FGC11788
FGC11788
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies