Top » Catalog » SNPs » A19688

$18.00

A19688
[A19688]

A19688
hg38 Position: ChrY:7991419..7991419
Ancestral: A
Derived: G
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A19688_F GGGTCAAGAACCACGTAAAAC
Reverse Primer: A19688_R CAAAGACAGTAGGATGTTTGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies