Top » Catalog » SNPs » BY4469

$18.00

BY4469
[BY4469]

BY4469
hg38 Position: ChrY:13215880..13215880
Ancestral: A
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY4469_F CAAGTCCATGACAACCATGC
Reverse Primer: BY4469_R GCCCAACACAAATCTGTAACC
Reviews

Customers who bought this product also purchased
BY4470
BY4470
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies