Top » Catalog » SNPs » A19689

$18.00

A19689
[A19689]

A19689
hg38 Position: ChrY:19077736..19077736
Ancestral: C
Derived: T
Reference: Ben Moore (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A19689_F GGTTTCCTTCGCAAACGTC
Reverse Primer: A19689_R GAATCTGGAGCCAACGCTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies