Top » Catalog » SNPs » FGC10130

$18.00

FGC10130
[FGC10130]

FGC10130
hg38 Position: ChrY:26387730..26387730
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b
Comments: Below L1335 > L1065 > FGC10122
Forward Primer: FGC10130_F TCATACACTGGGCTACCACATG
Reverse Primer: FGC10130_R CTTTTGTAATATTGTCTTACATTTTTATGGC
Reviews

Customers who bought this product also purchased
FGC10131
FGC10131
FGC10128
FGC10128
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies