Top » Catalog » SNPs » FGC10131

$18.00

FGC10131
[FGC10131]

FGC10131
hg38 Position: ChrY:20706391..20706395
Ancestral: del
Derived: ins
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b
Comments: Below L1335 > L1065 > FGC10122
Forward Primer: FGC10131_F TGGGTAAGAATGCACAAACC
Reverse Primer: FGC10131_R CCAATTTGGATGCCCTCTC
Reviews

Customers who bought this product also purchased
FGC10128
FGC10128
FGC10130
FGC10130
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies