Top » Catalog » SNPs » YFS4000659

$18.00

YFS4000659
[YFS4000659]

YFS4000659
hg38 Position: ChrY:14539393..14539393
Ancestral: G
Derived: A
Reference: Barbara Garrison (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: YFS4000659_F TGTTTTGGGGAGGAAATCTG
Reverse Primer: YFS4000659_R TGCCCCTAGAATGAGGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies