Top » Catalog » SNPs » FGC71256

$18.00

FGC71256
[FGC71256]

FGC71256
hg38 Position: ChrY:8584919..8584919
Ancestral: ins
Derived: del
Reference: Harold Eaton (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: FGC71256_F CCAGTTCATGGAGGATGACC
Reverse Primer: FGC71256_R ACCCACAACCTGGAGCATAG
Reviews

Customers who bought this product also purchased
YFS4728010
YFS4728010
FGC71254
FGC71254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies