Top » Catalog » SNPs » YFS4728010

$18.00

YFS4728010
[YFS4728010]

YFS4728010
hg38 Position: ChrY:21123007..21123007
Ancestral: G
Derived: A
Reference: Harold Eaton (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: YFS4728010_F TGGTTTTGCATTTCAACAGG
Reverse Primer: YFS4728010_R TTTCAAGGCTGAGTGTGGTG
Reviews

Customers who bought this product also purchased
FGC71254
FGC71254
FGC71256
FGC71256
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies