Top » Catalog » SNPs » FGC72373

$18.00

FGC72373
[FGC72373]

FGC72373
hg38 Position: ChrY:15492494..15492494
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: G
Comments: .
Forward Primer: FGC72373_F TTTGCTTCCTCTCACCCATC
Reverse Primer: FGC72373_R GTGTTCCTACCATGCACCAG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A20535
A20535
FGC72365
FGC72365
FGC72364
FGC72364
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies