Top » Catalog » SNPs » A19692

$18.00

A19692
[A19692]

A19692
hg38 Position: ChrY:7059564..7059564
Ancestral: T
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: DF95 > ZP85 > ZP84 > ZP121 > A19363
Forward Primer: A19692_F GGTTTTCCCCTGGGACTACAC
Reverse Primer: A19692_R GGTATAAAAACCATACAGGAAGCAC
Reviews

Customers who bought this product also purchased
A19693
A19693
A19698
A19698
YSEQ-Alpha
YSEQ-Alpha
A19697
A19697
DNA Sample Kit
DNA Sample Kit
A19696
A19696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies