Top » Catalog » SNPs » A19694

$18.00

A19694
[A19694]

A19694
hg38 Position: ChrY:8818364..8818364
Ancestral: A
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: DF95 > ZP85 > ZP84 > ZP121 > A19363
Forward Primer: A19694_F GGGGAATTATGCCTTACTTTTATATTTAG
Reverse Primer: A19694_R CTTCATTGTTAAATTACTTGCACCAG
Reviews

Customers who bought this product also purchased
A19693
A19693
A19699
A19699
A19692
A19692
A19698
A19698
YSEQ-Alpha
YSEQ-Alpha
A19697
A19697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies