Top » Catalog » SNPs » A19694

$18.00

A19694
[A19694]

A19694
hg38 Position: ChrY:8818364..8818364
Ancestral: A
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: DF95 > ZP85 > ZP84 > ZP121 > A19363
Forward Primer: A19694_F GGGGAATTATGCCTTACTTTTATATTTAG
Reverse Primer: A19694_R CTTCATTGTTAAATTACTTGCACCAG
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
A19697
A19697
DNA Sample Kit
DNA Sample Kit
A19696
A19696
HVR2
HVR2
Whole Genome Sequence
Whole Genome Sequence
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies