Top » Catalog » SNPs » A19695

$18.00

A19695
[A19695]

A19695
hg38 Position: ChrY:14370838..14370838
Ancestral: A
Derived: C
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: DF95 > ZP85 > ZP84 > ZP121 > A19363
Forward Primer: A19695_F GTCACCCTGTTGTGCTATCAGG
Reverse Primer: A19695_R GTAATAAAAAGAGATAAGCAGGCAGTG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
A19696
A19696
HVR2
HVR2
Whole Genome Sequence
Whole Genome Sequence
A19694
A19694
A19700
A19700
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies