Top » Catalog » SNPs » A19695

$18.00

A19695
[A19695]

A19695
hg38 Position: ChrY:14370838..14370838
Ancestral: A
Derived: C
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: DF95 > ZP85 > ZP84 > ZP121 > A19363
Forward Primer: A19695_F GTCACCCTGTTGTGCTATCAGG
Reverse Primer: A19695_R GTAATAAAAAGAGATAAGCAGGCAGTG
Reviews

Customers who bought this product also purchased
A19692
A19692
A19698
A19698
YSEQ-Alpha
YSEQ-Alpha
A19697
A19697
DNA Sample Kit
DNA Sample Kit
A19696
A19696
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies