Top » Catalog » SNPs » A19696

$18.00

A19696
[A19696]

A19696
hg38 Position: ChrY:15342219..15342219
Ancestral: G
Derived: T
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: DF95 > ZP85 > ZP84 > ZP121 > A19363
Forward Primer: A19696_F CAGGTACCCCAATCAAATGTAGG
Reverse Primer: A19696_R CAACCACAGTGGGAGTCCA
Reviews

Customers who bought this product also purchased
Whole Genome Sequence
Whole Genome Sequence
A19694
A19694
A19700
A19700
A19693
A19693
A19699
A19699
A19692
A19692
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies