Top » Catalog » SNPs » A19700

$18.00

A19700
[A19700]

A19700
hg38 Position: ChrY:20872491..20872491
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: DF95 > ZP85 > ZP84 > ZP121 > A19363
Forward Primer: A19700_F AAGGGAGAGCAGCAAGTGAG
Reverse Primer: A19700_R ATACCCACCCTCCCCTTTAC
Reviews

Customers who bought this product also purchased
A19694
A19694
A19699
A19699
A19693
A19693
A19698
A19698
A19692
A19692
A19697
A19697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies