Top » Catalog » SNPs » A19700

$18.00

A19700
[A19700]

A19700
hg38 Position: ChrY:20872491..20872491
Ancestral: G
Derived: A
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: DF95 > ZP85 > ZP84 > ZP121 > A19363
Forward Primer: A19700_F AAGGGAGAGCAGCAAGTGAG
Reverse Primer: A19700_R ATACCCACCCTCCCCTTTAC
Reviews

Customers who bought this product also purchased
A19692
A19692
A19697
A19697
YSEQ-Alpha
YSEQ-Alpha
A19696
A19696
DNA Sample Kit
DNA Sample Kit
A19695
A19695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies