Top » Catalog » SNPs » A19931

$18.00

A19931
[A19931]

A19931
hg38 Position: ChrY:14312463..14312463
Ancestral: C
Derived: T
Reference: Nasser Alanazi (2017)
ISOGG Haplogroup: J1
Comments: Downstream ZS2006 > ZS2010
Forward Primer: A19931_F GAGAATACACAACTATGCAAATATTACAAC
Reverse Primer: A19931_R ATAGTATTCGTGTTTAGAGGGCTGTG
Reviews

Customers who bought this product also purchased
A19930
A19930
A19929
A19929
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies