Top » Catalog » SNPs » L1333

$18.00

L1333
[L1333]

L1333
hg38 Position: ChrY:13004344..13004344
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1b5~
Comments: Below Z16385
Forward Primer: L1333_F TCCCAAAGTGCTGGGATTAC
Reverse Primer: L1333_R GCTTTGGCTCACACTCAGTACAT
Reviews

Customers who bought this product also purchased
L513
L513
Z16385
Z16385
Z39589
Z39589
CTS6621
CTS6621
DF13
DF13
Z16361
Z16361
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies