Top » Catalog » SNPs » L1333

$18.00

L1333
[L1333]

L1333
hg38 Position: ChrY:13004344..13004344
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1b5~
Comments: Below Z16385
Forward Primer: L1333_F TCCCAAAGTGCTGGGATTAC
Reverse Primer: L1333_R GCTTTGGCTCACACTCAGTACAT
Reviews

Customers who bought this product also purchased
DF13
DF13
Z16361
Z16361
Z17807
Z17807
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
R1b-L513 Panel
R1b-L513 Panel
FGC11791
FGC11791
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies