Top » Catalog » SNPs » L1333

$18.00

L1333
[L1333]

L1333
hg38 Position: ChrY:13004344..13004344
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1b5~
Comments: Below Z16385
Forward Primer: L1333_F TCCCAAAGTGCTGGGATTAC
Reverse Primer: L1333_R GCTTTGGCTCACACTCAGTACAT
Reviews

Customers who bought this product also purchased
R1b-L513 Panel
R1b-L513 Panel
FGC11791
FGC11791
S6365
S6365
BY359
BY359
L513
L513
Z16385
Z16385
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14042
$18.00
Haplogroup Info
Other products
Currencies