Top » Catalog » SNPs » A19934

$18.00

A19934
[A19934]

A19934
hg38 Position: ChrY:15402259..15402259
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A19934vl_F TGCTATGGCATTGGAGGTAAC
Reverse Primer: A19934vl_R AATACCGATAGTATGGGTAATATTCTGG
Reviews

Customers who bought this product also purchased
A19348
A19348
M12450
M12450
A19353
A19353
A19342
A19342
A19360
A19360
A19347
A19347
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies