Top » Catalog » SNPs » A19934

$18.00

A19934
[A19934]

A19934
hg38 Position: ChrY:15402259..15402259
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A19934vl_F TGCTATGGCATTGGAGGTAAC
Reverse Primer: A19934vl_R AATACCGATAGTATGGGTAATATTCTGG
Reviews

Customers who bought this product also purchased
A19350
A19350
A20673
A20673
A19355
A19355
A19344
A19344
A19933
A19933
A19349
A19349
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies