Top » Catalog » SNPs » A19934

$18.00

A19934
[A19934]

A19934
hg38 Position: ChrY:15402259..15402259
Ancestral: G
Derived: T
Reference: Petr Soucek (2017)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: A19934vl_F TGCTATGGCATTGGAGGTAAC
Reverse Primer: A19934vl_R AATACCGATAGTATGGGTAATATTCTGG
Reviews

Customers who bought this product also purchased
A19341
A19341
A19357
A19357
A19346
A19346
M12429
M12429
A19351
A19351
R1a-P278 Kristofoli Panel
R1a-P278 Kristofoli Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies