Top » Catalog » SNPs » CTS10301

$18.00

CTS10301
[CTS10301]

CTS10301
hg38 Position: ChrY:17270733..17270733
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1a
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS10301_F CTGGAACTCCTGGGCTGTAG
Reverse Primer: CTS10301_R AGGGAGGCTGAGGACTTTTG
Reviews

Customers who bought this product also purchased
A19343
A19343
A19932
A19932
A19348
A19348
M12450
M12450
A19353
A19353
A19342
A19342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies