Top » Catalog » SNPs » CTS10301

$18.00

CTS10301
[CTS10301]

CTS10301
hg38 Position: ChrY:17270733..17270733
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1a
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS10301_F CTGGAACTCCTGGGCTGTAG
Reverse Primer: CTS10301_R AGGGAGGCTGAGGACTTTTG
Reviews

Customers who bought this product also purchased
A19355
A19355
A19933
A19933
A19344
A19344
M12462
M12462
A19349
A19349
A19354
A19354
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies