Top » Catalog » SNPs » M12430

$18.00

M12430
[M12430]

M12430
hg38 Position: ChrY:6887802..6887802
Ancestral: G
Derived: T
Reference: Underhill et al (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Found in P0 Genomic Blood
Forward Primer: M12430_F ATGCTCTCCCTCCATTTGC
Reverse Primer: M12430_R TAGTTTGGCCATTGTGCAAG
Reviews

Customers who bought this product also purchased
A19346
A19346
CTS10301
CTS10301
A19351
A19351
R1a-P278 Kristofoli Panel
R1a-P278 Kristofoli Panel
A19356
A19356
A19345
A19345
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies