Top » Catalog » SNPs » M12450

$18.00

M12450
[M12450]

M12450
hg38 Position: ChrY:14773319..14773319
Ancestral: A
Derived: T
Reference: Underhill et al (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Found in P0 Genomic Blood
Forward Primer: M12450_F TCATCTGAGCCCCAAATCTC
Reverse Primer: M12450_R GACGGGGAGAGGACTGAATC
Reviews

Customers who bought this product also purchased
A19346
A19346
CTS10301
CTS10301
A19351
A19351
R1a-P278 Kristofoli Panel
R1a-P278 Kristofoli Panel
A19356
A19356
A19345
A19345
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies