Top » Catalog » SNPs » FGC21077

$18.00

FGC21077
[FGC21077]

FGC21077
hg38 Position: ChrY:7076115..7076115
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > L70 > CTS6061 > PF5456
Forward Primer: FGC21077_F ACCCAGGCTGCAGTAGAGTG
Reverse Primer: FGC21077_R GGGGAGAAAATCCTTCCATC
Reviews

Customers who bought this product also purchased
A19087
A19087
FGC21087
FGC21087
Y24651
Y24651
A18941
A18941
FGC21081
FGC21081
FGC21094
FGC21094
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies