Top » Catalog » SNPs » Z16395

$18.00

Z16395
[Z16395]

Z16395
hg38 Position: ChrY:17161612..17161612
Ancestral: G
Derived: A
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b2c1a
Comments: downstream of L513
Forward Primer: Z16395_F CCCTTTTCAGCAGTGGAATG
Reverse Primer: Z16395_R ACTTGTGGGCATATCATTGTC
Reviews

Customers who bought this product also purchased
Z17809
Z17809
FGC11788
FGC11788
Z16396
Z16396
Z17808
Z17808
Z16392
Z16392
Z17806
Z17806
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies