Top » Catalog » SNPs » FGC21081

$18.00

FGC21081
[FGC21081]

FGC21081
hg38 Position: ChrY:8758745..8758745
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: not listed
Comments: Below L25 > L70 > CTS6061 > PF5456
Forward Primer: FGC21081_F GGCTTAGATGCCCAGATGTC
Reverse Primer: FGC21081_R GAGGTGGTGAGGTCAAGAGC
Reviews

Customers who bought this product also purchased
FGC21080
FGC21080
FGC21094
FGC21094
J2-BY268-Kessler Panel
J2-BY268-Kessler Panel
FGC21079
FGC21079
FGC21092
FGC21092
FGC21077
FGC21077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies