Top » Catalog » SNPs » FGC21087

$18.00

FGC21087
[FGC21087]

FGC21087
hg38 Position: ChrY:14282172..14282172
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > L70 > CTS6061 > PF5456
Forward Primer: FGC21087_F TGCATTGGACATTACATGGTG
Reverse Primer: FGC21087_R CTGTCTGACAATCCCCAGTG
Reviews

Customers who bought this product also purchased
FGC21080
FGC21080
FGC21094
FGC21094
J2-BY268-Kessler Panel
J2-BY268-Kessler Panel
FGC21079
FGC21079
FGC21092
FGC21092
FGC21077
FGC21077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies