Top » Catalog » SNPs » FGC21087

$18.00

FGC21087
[FGC21087]

FGC21087
hg38 Position: ChrY:14282172..14282172
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > L70 > CTS6061 > PF5456
Forward Primer: FGC21087_F TGCATTGGACATTACATGGTG
Reverse Primer: FGC21087_R CTGTCTGACAATCCCCAGTG
Reviews

Customers who bought this product also purchased
FGC21088
FGC21088
A19087
A19087
FGC21081
FGC21081
Y24651
Y24651
A18941
A18941
FGC21080
FGC21080
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies