Top » Catalog » SNPs » FGC21102

$18.00

FGC21102
[FGC21102]

FGC21102
hg38 Position: ChrY:7714248..7714248
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21102v2_F CAGAGTCCCTGCCCCTGC
Reverse Primer: FGC21102v2_R GACGTCCATAGTCAATGTTCTGG
Reviews

Customers who bought this product also purchased
A19100
A19100
A19315
A19315
A19113
A19113
FGC21104
FGC21104
A19080
A19080
A19152
A19152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies