Top » Catalog » SNPs » FGC21112

$18.00

FGC21112
[FGC21112]

FGC21112
hg38 Position: ChrY:20838947..20838947
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21112_F TGCTCTATTTGCTCAAAATTGG
Reverse Primer: FGC21112_R TGCAAAAATTAGTGGCATTTTC
Reviews

Customers who bought this product also purchased
A19081
A19081
A19153
A19153
FGC21109
FGC21109
A19100
A19100
A19315
A19315
A19113
A19113
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies