Top » Catalog » SNPs » FGC21112

$18.00

FGC21112
[FGC21112]

FGC21112
hg38 Position: ChrY:20838947..20838947
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21112_F TGCTCTATTTGCTCAAAATTGG
Reverse Primer: FGC21112_R TGCAAAAATTAGTGGCATTTTC
Reviews

Customers who bought this product also purchased
A19077
A19077
A19142
A19142
FGC21107
FGC21107
A19088
A19088
A19159
A19159
FGC21114
FGC21114
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies