Top » Catalog » SNPs » FGC21112

$18.00

FGC21112
[FGC21112]

FGC21112
hg38 Position: ChrY:20838947..20838947
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21112_F TGCTCTATTTGCTCAAAATTGG
Reverse Primer: FGC21112_R TGCAAAAATTAGTGGCATTTTC
Reviews

Customers who bought this product also purchased
A19105
A19105
A19317
A19317
A19126
A19126
FGC21105
FGC21105
A19084
A19084
A19155
A19155
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies