Top » Catalog » SNPs » FGC21112

$18.00

FGC21112
[FGC21112]

FGC21112
hg38 Position: ChrY:20838947..20838947
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21112_F TGCTCTATTTGCTCAAAATTGG
Reverse Primer: FGC21112_R TGCAAAAATTAGTGGCATTTTC
Reviews

Customers who bought this product also purchased
A19086
A19086
A19156
A19156
FGC21113
FGC21113
A19105
A19105
A19317
A19317
A19126
A19126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies