Top » Catalog » SNPs » FGC21113

$18.00

FGC21113
[FGC21113]

FGC21113
hg38 Position: ChrY:21204900..21204900
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC21113_F CCTGGTGAATCCAACAATAAGG
Reverse Primer: FGC21113_R ATCTGCGTTGAAAAGGGATG
Reviews

Customers who bought this product also purchased
A19105
A19105
A19317
A19317
A19126
A19126
FGC21105
FGC21105
A19155
A19155
FGC21110
FGC21110
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies